View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF21643_high_31 (Length: 234)

Name: NF21643_high_31
Description: NF21643
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF21643_high_31
NF21643_high_31
[»] chr7 (2 HSPs)
chr7 (1-160)||(29765820-29765979)
chr7 (184-223)||(29766002-29766041)


Alignment Details
Target: chr7 (Bit Score: 160; Significance: 2e-85; HSPs: 2)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 160; E-Value: 2e-85
Query Start/End: Original strand, 1 - 160
Target Start/End: Original strand, 29765820 - 29765979
Alignment:
1 ccgccttgtgatctgttgcctgatcaagggcctgagaaaatcggggcgtgtgatttcccagcagagagtttacctattgataatttggagcttaagaagt 100  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
29765820 ccgccttgtgatctgttgcctgatcaagggcctgagaaaatcggggcgtgtgatttcccagcagagagtttacctattgataatttggagcttaagaagt 29765919  T
101 gtagttacagcatgaaatatgtaatgtagttactgttgaggaatgatctgtatcaaacag 160  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
29765920 gtagttacagcatgaaatatgtaatgtagttactgttgaggaatgatctgtatcaaacag 29765979  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #2
Raw Score: 40; E-Value: 0.00000000000008
Query Start/End: Original strand, 184 - 223
Target Start/End: Original strand, 29766002 - 29766041
Alignment:
184 ctctactagtttatggaacttgatggcttgatgaatgatg 223  Q
    ||||||||||||||||||||||||||||||||||||||||    
29766002 ctctactagtttatggaacttgatggcttgatgaatgatg 29766041  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University