View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF21643_low_18 (Length: 295)
Name: NF21643_low_18
Description: NF21643
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF21643_low_18 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 238; Significance: 1e-132; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 238; E-Value: 1e-132
Query Start/End: Original strand, 1 - 283
Target Start/End: Complemental strand, 51689080 - 51688810
Alignment:
| Q |
1 |
cctatataataatcccataaaactttttgaaagcagcagctttgcttgctggtgtctcaaaagcggttgacttcactgctgtctcagaatatatatcaac |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
51689080 |
cctatataataatcccataaaactttttgaaagcagcagctttgctttctggtgtctcaaaagcggttgacttcactgctgtctcagaatatatatcaac |
51688981 |
T |
|
| Q |
101 |
ctttttctgtagctacctcttctgcaggttgtttataaattttacatatacagttcagtgtccttactgtaatatattatgtggctcaggctcaggctca |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
51688980 |
ctttttctgtagctacctcttctgcaggttgtttataaattttacatatacagttcagtgtccttactgtaatatattatgtggctcaggc--------- |
51688890 |
T |
|
| Q |
201 |
ggctcagctgcatcaaaattcagaatagcatgttctcacccctagccaacaaccaagataaatatatttatttacttgaccat |
283 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
51688889 |
---tcagctgcatcaaaattcagaatagcatgttctcacccctagccaacaaccaagataaatatatttatttacttgaccat |
51688810 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University