View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF21643_low_29 (Length: 238)
Name: NF21643_low_29
Description: NF21643
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF21643_low_29 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 126; Significance: 4e-65; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 126; E-Value: 4e-65
Query Start/End: Original strand, 1 - 221
Target Start/End: Original strand, 51689146 - 51689377
Alignment:
| Q |
1 |
caagatacacgattactttatgaatactaatcattaggtagttagagatgcttttgtttattt--------------tttaaagaaagagagatgctttt |
86 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |||||||||||||||||||||| |
|
|
| T |
51689146 |
caagatacacgattactttatgaatactaatcattaggtagttagagatgcttttgtatatttatttatttattttttttaaagaaagagagatgcttta |
51689245 |
T |
 |
| Q |
87 |
gttttgtcaaatgcacacatagccccgtttgtgatannnnnnnnnn-aataaacagaaagaacaattgttagcttgcttgaggagtgaggactttagtta |
185 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| ||||||||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
51689246 |
gttttgtcaaatgcacacatagccccgtttgtgatatttttttttttaataaacagaa----caattgttagcttgcttgaggagtgaggactttagtta |
51689341 |
T |
 |
| Q |
186 |
gggcattaagtggatgacacgaaatcatttggtaaa |
221 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| |
|
|
| T |
51689342 |
gggcattaagtggatgacacgaaatcatttggtaaa |
51689377 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University