View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF21643_low_31 (Length: 234)
Name: NF21643_low_31
Description: NF21643
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF21643_low_31 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 160; Significance: 2e-85; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 160; E-Value: 2e-85
Query Start/End: Original strand, 1 - 160
Target Start/End: Original strand, 29765820 - 29765979
Alignment:
| Q |
1 |
ccgccttgtgatctgttgcctgatcaagggcctgagaaaatcggggcgtgtgatttcccagcagagagtttacctattgataatttggagcttaagaagt |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29765820 |
ccgccttgtgatctgttgcctgatcaagggcctgagaaaatcggggcgtgtgatttcccagcagagagtttacctattgataatttggagcttaagaagt |
29765919 |
T |
 |
| Q |
101 |
gtagttacagcatgaaatatgtaatgtagttactgttgaggaatgatctgtatcaaacag |
160 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29765920 |
gtagttacagcatgaaatatgtaatgtagttactgttgaggaatgatctgtatcaaacag |
29765979 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 40; E-Value: 0.00000000000008
Query Start/End: Original strand, 184 - 223
Target Start/End: Original strand, 29766002 - 29766041
Alignment:
| Q |
184 |
ctctactagtttatggaacttgatggcttgatgaatgatg |
223 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29766002 |
ctctactagtttatggaacttgatggcttgatgaatgatg |
29766041 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University