View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF21643_low_32 (Length: 221)
Name: NF21643_low_32
Description: NF21643
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF21643_low_32 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 107; Significance: 8e-54; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 107; E-Value: 8e-54
Query Start/End: Original strand, 1 - 165
Target Start/End: Original strand, 39900880 - 39901047
Alignment:
| Q |
1 |
gactaattaaaaataatttgtgactgcttaattagatattctttcatctttcnnnnnnnnnnnnn---tagatattctttcaaatcagcatgttgaatga |
97 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||| | |||||||||||||| |
|
|
| T |
39900880 |
gactaattaaaaataatttgtgactgcttaattagatattctttcatctttcaaaaaaaaaaaaaaaatagatattctttcaattgagcatgttgaatga |
39900979 |
T |
 |
| Q |
98 |
atctcgaaagcttaggaagtgtctggccacctaacctactacaaagcaaaactgatataattaacttt |
165 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39900980 |
atctcgaaagcttaggaagtgtctggccacctaacctactacaaagcaaaactgatataattaacttt |
39901047 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 177 - 221
Target Start/End: Original strand, 39901041 - 39901085
Alignment:
| Q |
177 |
taacttttctaatgatacgttatccattttatttaacactgtaat |
221 |
Q |
| |
|
||||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
39901041 |
taacttttctaatgatacggcatccattttatttaacactgtaat |
39901085 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University