View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF21645_high_6 (Length: 270)
Name: NF21645_high_6
Description: NF21645
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF21645_high_6 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 223; Significance: 1e-123; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 223; E-Value: 1e-123
Query Start/End: Original strand, 16 - 254
Target Start/End: Original strand, 20043754 - 20043992
Alignment:
| Q |
16 |
gatgaacatatgtggtcactagcaccagaatccacaatccaagaaccaattttggaatgatgtaatgagtaagaaattctagagatacctgaagtggtat |
115 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| | |||| |
|
|
| T |
20043754 |
gatgaacatatgtggtcactagcaccagaatccacaatccaagaaccaattttggaatgatgtaatgagtaagaaattctagagatacctgaattagtat |
20043853 |
T |
 |
| Q |
116 |
gacttgtaacatgtgaaaccaccttacttgtggaaccagaaggagtagccagcagattcaccaagtgttcatattgctccttggtaaaaccataagactc |
215 |
Q |
| |
|
|||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
20043854 |
gacttgtaacgtgtgaaaccaccttacttgtggaaccagaaggagtagccagcagattcaccaagtgttcatattgctccttggtaaaaccataagactc |
20043953 |
T |
 |
| Q |
216 |
agtacccctacaactctttgaatcatcaaggtcctctct |
254 |
Q |
| |
|
|||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
20043954 |
agtacccctacaactctttgaatcatcaagttcctctct |
20043992 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 31; Significance: 0.00000002; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 186 - 244
Target Start/End: Complemental strand, 28302493 - 28302435
Alignment:
| Q |
186 |
atattgctccttggtaaaaccataagactcagtacccctacaactctttgaatcatcaa |
244 |
Q |
| |
|
||||| ||||||||| || ||||| || ||||||||| || |||||||||||||||||| |
|
|
| T |
28302493 |
atattactccttggtgaagccataggattcagtacccttataactctttgaatcatcaa |
28302435 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University