View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF21645_high_7 (Length: 218)
Name: NF21645_high_7
Description: NF21645
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF21645_high_7 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 192; Significance: 1e-104; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 192; E-Value: 1e-104
Query Start/End: Original strand, 1 - 203
Target Start/End: Complemental strand, 43103124 - 43102921
Alignment:
| Q |
1 |
taaaatcatatt-gtcttcttcccctaacaagacaaacataatcatggagcaagtgcatttggtaagtgactacaccaaaccaaatacatgttccttttc |
99 |
Q |
| |
|
|||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43103124 |
taaaatcatatttgtcttcttcccctaacaagacaaacataatcatggagcaagtgcatttggtaagtgactacaccaaaccaaatacatgttccttttc |
43103025 |
T |
 |
| Q |
100 |
aaccatcatggaagaaatgaaatccctaatgatgcttgcttttccaatagccataacagctcttattttctactctcgttccatggtgtccatgatgttt |
199 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
43103024 |
aaccatcatggaagaaatgaaatccctaatgatgcttgcttttccaatagccataacagctcttattttctattctcgttccatggtgtccatgatgttt |
43102925 |
T |
 |
| Q |
200 |
ttag |
203 |
Q |
| |
|
|||| |
|
|
| T |
43102924 |
ttag |
43102921 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University