View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF21645_low_9 (Length: 217)
Name: NF21645_low_9
Description: NF21645
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF21645_low_9 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 120; Significance: 1e-61; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 120; E-Value: 1e-61
Query Start/End: Original strand, 63 - 207
Target Start/End: Complemental strand, 14768839 - 14768695
Alignment:
| Q |
63 |
attatagaggggttattcatttacagnnnnnnnttctttcagatgccctgaaaacaaaggagaagatagatagcattgggttgggagcaaataagttgga |
162 |
Q |
| |
|
|||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
14768839 |
attatagaggggttattcatttacagaaaaaaattctttcagatgccctgaaaacaaaggagaagatagatagtattgggttgggagcaaataagttgga |
14768740 |
T |
|
| Q |
163 |
gacaagacttagagggaaaaaggtattcattgtacttgatgatgt |
207 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
14768739 |
gacaagacttagagggaaaaaggtattcattgtacttgatgatgt |
14768695 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 66; E-Value: 2e-29
Query Start/End: Original strand, 1 - 70
Target Start/End: Original strand, 14768845 - 14768914
Alignment:
| Q |
1 |
ttttcacaagcttctctgatattttcaacgaaacttctatgcacaaacttgcgatgaattcgattataga |
70 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
14768845 |
ttttcacaagcttctctgatattttcaacgaaacttctatgcacaaacttgcgatgaattcgattgtaga |
14768914 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 33; Significance: 0.000000001; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 2 - 70
Target Start/End: Complemental strand, 30416079 - 30416011
Alignment:
| Q |
2 |
tttcacaagcttctctgatattttcaacgaaacttctatgcacaaacttgcgatgaattcgattataga |
70 |
Q |
| |
|
||||||||| |||||| |||||||| | ||||||||| | |||||| |||||||||||| |||| |||| |
|
|
| T |
30416079 |
tttcacaagtttctctaatattttcgatgaaacttctgtacacaaatttgcgatgaatttgattgtaga |
30416011 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 30; Significance: 0.00000007; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 30; E-Value: 0.00000007
Query Start/End: Original strand, 1 - 70
Target Start/End: Original strand, 7166591 - 7166660
Alignment:
| Q |
1 |
ttttcacaagcttctctgatattttcaacgaaacttctatgcacaaacttgcgatgaattcgattataga |
70 |
Q |
| |
|
|||||||| ||||||| | ||||||| ||||||||||| || ||| |||||||||||| ||||||||| |
|
|
| T |
7166591 |
ttttcacatacttctctaacgttttcaatgaaacttctattcaaaaatttgcgatgaatttgattataga |
7166660 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 30; Significance: 0.00000007; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 30; E-Value: 0.00000007
Query Start/End: Original strand, 19 - 60
Target Start/End: Original strand, 6907789 - 6907830
Alignment:
| Q |
19 |
atattttcaacgaaacttctatgcacaaacttgcgatgaatt |
60 |
Q |
| |
|
||||| |||| |||||||||||||||||| |||||||||||| |
|
|
| T |
6907789 |
atattctcaatgaaacttctatgcacaaatttgcgatgaatt |
6907830 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University