View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF21646_high_8 (Length: 230)
Name: NF21646_high_8
Description: NF21646
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF21646_high_8 |
 | |
|
| [»] chr8 (1 HSPs) |
| |
|
Alignment Details
Target: chr8 (Bit Score: 103; Significance: 2e-51; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 103; E-Value: 2e-51
Query Start/End: Original strand, 1 - 230
Target Start/End: Complemental strand, 5415777 - 5415548
Alignment:
| Q |
1 |
catcttcgtccaaaagctaaagacattagatatacgagtctctttacttaaatcttgctcaacatccactttttcaaatgtaagactcttactcacactt |
100 |
Q |
| |
|
||||||||| |||||||||||||||||||||||| | |||||||||||||||||| |||| |||||||||| |||||||||||||||||||||||||| |
|
|
| T |
5415777 |
catcttcgttcaaaagctaaagacattagatatatggatctctttacttaaatcttattcaaaatccacttttccaaatgtaagactcttactcacactt |
5415678 |
T |
|
| Q |
101 |
gatatatcaacgatttatcnnnnnnnnnnnnnnnnnnnnnnnnnatattacctttgacacatctagaatgacatgtcattgttgccacatatgactaata |
200 |
Q |
| |
|
||||||||||||||||||| |||||| ||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5415677 |
gatatatcaacgatttatcttttttattttatttttatttttttatattatctttgacacatctagaatgacatgtcattgttgccacatatgactaata |
5415578 |
T |
|
| Q |
201 |
ttttcacttgaagtcttcttcgccttcatc |
230 |
Q |
| |
|
|| |||| |||||||| |||| |||||||| |
|
|
| T |
5415577 |
ttctcacgtgaagtctacttcaccttcatc |
5415548 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University