View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF21647_high_11 (Length: 347)
Name: NF21647_high_11
Description: NF21647
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF21647_high_11 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 124; Significance: 1e-63; HSPs: 3)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 124; E-Value: 1e-63
Query Start/End: Original strand, 151 - 282
Target Start/End: Complemental strand, 12819285 - 12819154
Alignment:
| Q |
151 |
ttgctttcaccaacttttgttttcaagaaaatagtgcagaaaatatggtctatatctatatactaaaagaaaatctctctttgaatgttttcccactctc |
250 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
12819285 |
ttgctttcaccaacttttgttttcaagaaaatagtgcagaaaatatggtctatatctatatactataagaaaatctctctttgaatgttttcccactctc |
12819186 |
T |
|
| Q |
251 |
gattttattgggtgtcttatatatttttaaca |
282 |
Q |
| |
|
||||| |||||||||||||||||||||||||| |
|
|
| T |
12819185 |
gatttcattgggtgtcttatatatttttaaca |
12819154 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 113; E-Value: 4e-57
Query Start/End: Original strand, 10 - 142
Target Start/End: Complemental strand, 12819468 - 12819336
Alignment:
| Q |
10 |
ataatactgcatagtactctatgatacatacctcaatggataatgataactgattcatacgaagaatgtcgtggtcctttgacattgttccttatattgc |
109 |
Q |
| |
|
||||||||||||||||| ||||||||||||||||||| |||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
12819468 |
ataatactgcatagtacgctatgatacatacctcaattgataatgataactgattcatacgaagaatgccgtggtcctttgacattgttccttatattgc |
12819369 |
T |
|
| Q |
110 |
ttttctgatatctttgcatgacctgttgagttt |
142 |
Q |
| |
|
|||||||| ||||||||| |||||||||||||| |
|
|
| T |
12819368 |
ttttctgagatctttgcaggacctgttgagttt |
12819336 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #3
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 315 - 347
Target Start/End: Complemental strand, 12819138 - 12819106
Alignment:
| Q |
315 |
tttgcaagaatctagggacttctttaccataat |
347 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |
|
|
| T |
12819138 |
tttgcaagaatctagggacttctttaccataat |
12819106 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University