View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF21648_high_26 (Length: 294)
Name: NF21648_high_26
Description: NF21648
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF21648_high_26 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 230; Significance: 1e-127; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 230; E-Value: 1e-127
Query Start/End: Original strand, 45 - 286
Target Start/End: Original strand, 2231823 - 2232064
Alignment:
| Q |
45 |
tgtattttttgtcttatttccattatacattttcataatatatggtgatcatagacttgaattgaatgaatagctctatagttcatatatctcaagaaat |
144 |
Q |
| |
|
|||||||||||||| ||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2231823 |
tgtattttttgtctcatttccattatacgttttcataatatatggtgatcatagacttgaattgaatgaatagctctatagttcatatatctcaagaaat |
2231922 |
T |
 |
| Q |
145 |
cattctctattcagctatgggaccatttagaggaataactgaagatttcaaaggaagacttgaattttataaacaagattggatttgtgcaatttgtact |
244 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2231923 |
cattctctattcagctatgggaccatttagaggaataactgaagatttcaaaggaagacttgaattttataaacaagattggatttgtgcaatttgtact |
2232022 |
T |
 |
| Q |
245 |
ggtgttagaatattggccccaactttctacatattctctgct |
286 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
2232023 |
ggtgttagaatattggccccaactttctacatattctttgct |
2232064 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University