View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF21648_high_28 (Length: 283)
Name: NF21648_high_28
Description: NF21648
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF21648_high_28 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 215; Significance: 1e-118; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 215; E-Value: 1e-118
Query Start/End: Original strand, 20 - 265
Target Start/End: Original strand, 17823131 - 17823377
Alignment:
| Q |
20 |
tgataaacatggataaatctaaagattgaatagaaaataagagtttctggtctgagtgatattgcaacgtaccaaatcgccggacactgtcgaggtttaa |
119 |
Q |
| |
|
|||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| || |
|
|
| T |
17823131 |
tgataaacttggataaatctaaagattgaatagaaaataagagtttctggtctgagtgatattgcaacgtaccaaatcgccggacactgtcgaggtctat |
17823230 |
T |
 |
| Q |
120 |
tcgattgctacccttaaacgaagcaagtgaaaaattgggatttctcttcaattatact-cttgttatgagctttttggaataagggggcgaattattttg |
218 |
Q |
| |
|
||||||||| ||||||||||||| |||||||||||||||||||||||||||||||||| || |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
17823231 |
tcgattgctgcccttaaacgaagaaagtgaaaaattgggatttctcttcaattatactactagttatgagctttttggaataagggggcgaattattttg |
17823330 |
T |
 |
| Q |
219 |
ttttacaaatatttagagtttttccctaaaaaagatataatttagag |
265 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
17823331 |
ttttacaaatatttagagtttttccctaaaaaagatataatttagag |
17823377 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University