View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF21648_high_28 (Length: 283)

Name: NF21648_high_28
Description: NF21648
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF21648_high_28
NF21648_high_28
[»] chr4 (1 HSPs)
chr4 (20-265)||(17823131-17823377)


Alignment Details
Target: chr4 (Bit Score: 215; Significance: 1e-118; HSPs: 1)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 215; E-Value: 1e-118
Query Start/End: Original strand, 20 - 265
Target Start/End: Original strand, 17823131 - 17823377
Alignment:
20 tgataaacatggataaatctaaagattgaatagaaaataagagtttctggtctgagtgatattgcaacgtaccaaatcgccggacactgtcgaggtttaa 119  Q
    |||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||     
17823131 tgataaacttggataaatctaaagattgaatagaaaataagagtttctggtctgagtgatattgcaacgtaccaaatcgccggacactgtcgaggtctat 17823230  T
120 tcgattgctacccttaaacgaagcaagtgaaaaattgggatttctcttcaattatact-cttgttatgagctttttggaataagggggcgaattattttg 218  Q
    ||||||||| ||||||||||||| |||||||||||||||||||||||||||||||||| || ||||||||||||||||||||||||||||||||||||||    
17823231 tcgattgctgcccttaaacgaagaaagtgaaaaattgggatttctcttcaattatactactagttatgagctttttggaataagggggcgaattattttg 17823330  T
219 ttttacaaatatttagagtttttccctaaaaaagatataatttagag 265  Q
    |||||||||||||||||||||||||||||||||||||||||||||||    
17823331 ttttacaaatatttagagtttttccctaaaaaagatataatttagag 17823377  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University