View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF21648_high_31 (Length: 265)
Name: NF21648_high_31
Description: NF21648
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF21648_high_31 |
 |  |
|
| [»] chr1 (2 HSPs) |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 244; Significance: 1e-135; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 244; E-Value: 1e-135
Query Start/End: Original strand, 6 - 265
Target Start/End: Complemental strand, 31231776 - 31231518
Alignment:
| Q |
6 |
agaaagttgtgtcgacaaagagagggggaaggaaatgagaattagagaatagttagattatagttttagtgttgttgtaaagttgtttattgctgaatgt |
105 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31231776 |
agaaagttgtgtcgacaaagagagggggaaggaaatgagaattagagaatagttagcttatagttttagtgttgttgtaaagttgtttattgctgaatgt |
31231677 |
T |
 |
| Q |
106 |
agtggttctgcatgtgtatttacaattacaacatcaaataggatttttattgaagtttttagattctaaattaacgtttggatttgccttgtatttcttt |
205 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31231676 |
agtggttctgcatgtgtatttacaattacaacatcaaataggatttttattgaagtttttagattctaaattaacgtttggatttgccttgtatttcttt |
31231577 |
T |
 |
| Q |
206 |
actattaattgaacaatgaaattattttatcccttagatttgttttatttctttactatt |
265 |
Q |
| |
|
||||||||||||||||||||||||||||||| ||| |||||||||||||||||||||||| |
|
|
| T |
31231576 |
actattaattgaacaatgaaattattttatctctt-gatttgttttatttctttactatt |
31231518 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 197 - 240
Target Start/End: Complemental strand, 31231532 - 31231489
Alignment:
| Q |
197 |
tatttctttactattaattgaacaatgaaattattttatccctt |
240 |
Q |
| |
|
|||||||||||||||||||||||||||||| ||| ||||||||| |
|
|
| T |
31231532 |
tatttctttactattaattgaacaatgaaactatcttatccctt |
31231489 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University