View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF21648_high_33 (Length: 250)
Name: NF21648_high_33
Description: NF21648
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF21648_high_33 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 132; Significance: 1e-68; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 132; E-Value: 1e-68
Query Start/End: Original strand, 106 - 241
Target Start/End: Original strand, 12830410 - 12830545
Alignment:
| Q |
106 |
accttgaggcaagtatcactaatatgaacactacaaatttaatatcactaaaaccgaaaatgattatgttgcaagttaatagaataaaaggacaaaattc |
205 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
12830410 |
accttgaggcaagtatcactaatatgaacactacaaatttaatatcactaaaaccgaaaatgattattttgcaagttaatagaataaaaggacaaaattc |
12830509 |
T |
|
| Q |
206 |
ttacaaatattaatgaataaaagtgacaagtataat |
241 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| |
|
|
| T |
12830510 |
ttacaaatattaatgaataaaagtgacaagtataat |
12830545 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University