View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF21648_high_41 (Length: 235)
Name: NF21648_high_41
Description: NF21648
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF21648_high_41 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 200; Significance: 1e-109; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 200; E-Value: 1e-109
Query Start/End: Original strand, 18 - 221
Target Start/End: Original strand, 30897651 - 30897854
Alignment:
| Q |
18 |
gaaagtattattggcatgagctgtaacaacattatgcgcactgagttgttacggcattgaagaatgtgcctaaatgctaatctgaagcctctcttcatct |
117 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30897651 |
gaaagtattattggcatgagctgtaacaacattatgcgcactgagttgttacggcgttgaagaatgtgcctaaatgctaatctgaagcctctcttcatct |
30897750 |
T |
 |
| Q |
118 |
ttgattcaaaacaaaaaatcatgaatatcgaatatgattcaataaattatatttatttgggtaagagattgtatctcttactggcatcatcttacaagta |
217 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30897751 |
ttgattcaaaacaaaaaatcatgaatatcgaatatgattcaataaattatatttatttgggtaagagattgtatctcttactggcatcatcttacaagta |
30897850 |
T |
 |
| Q |
218 |
taat |
221 |
Q |
| |
|
|||| |
|
|
| T |
30897851 |
taat |
30897854 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 32; Significance: 0.000000005; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 62 - 105
Target Start/End: Complemental strand, 43957438 - 43957395
Alignment:
| Q |
62 |
gttgttacggcattgaagaatgtgcctaaatgctaatctgaagc |
105 |
Q |
| |
|
|||||||| || |||||||||||||||| ||||||||||||||| |
|
|
| T |
43957438 |
gttgttacagctttgaagaatgtgcctatatgctaatctgaagc |
43957395 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University