View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF21648_low_3 (Length: 606)
Name: NF21648_low_3
Description: NF21648
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF21648_low_3 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 107; Significance: 2e-53; HSPs: 8)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 107; E-Value: 2e-53
Query Start/End: Original strand, 262 - 376
Target Start/End: Complemental strand, 23688745 - 23688631
Alignment:
| Q |
262 |
aacatgacttttttcaaatttaatagataattgtcgatgagtgttgactcattgaggttgtggattcagtattcgatgtcaatgggacgacatcttttat |
361 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||| || |
|
|
| T |
23688745 |
aacatgacttttttcaaatttaatagataattgtcgatgagtgttgactcattgaggttgtggattcagtattcgatgtcgatgggacgacatctttgat |
23688646 |
T |
|
| Q |
362 |
gggagatttgtaagt |
376 |
Q |
| |
|
||||||||||||||| |
|
|
| T |
23688645 |
gggagatttgtaagt |
23688631 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 107; E-Value: 2e-53
Query Start/End: Original strand, 262 - 376
Target Start/End: Complemental strand, 24060982 - 24060868
Alignment:
| Q |
262 |
aacatgacttttttcaaatttaatagataattgtcgatgagtgttgactcattgaggttgtggattcagtattcgatgtcaatgggacgacatcttttat |
361 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||| || |
|
|
| T |
24060982 |
aacatgacttttttcaaatttaatagataattgtcgatgagtgttgactcattgaggttgtggattcagtattcgatgtcgatgggacgacatctttgat |
24060883 |
T |
|
| Q |
362 |
gggagatttgtaagt |
376 |
Q |
| |
|
||||||||||||||| |
|
|
| T |
24060882 |
gggagatttgtaagt |
24060868 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #3
Raw Score: 78; E-Value: 5e-36
Query Start/End: Original strand, 375 - 456
Target Start/End: Complemental strand, 23688598 - 23688517
Alignment:
| Q |
375 |
gtcccgaccttagtgattgcaggtgaaactcacctaaacttattgtagccgactttctatatcctttttaaaccctaaaccc |
456 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
23688598 |
gtcccgaccttagtgattgcaggtgaaactcacctaaacttattgtagccgattttctatatcctttttaaaccctaaaccc |
23688517 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #4
Raw Score: 78; E-Value: 5e-36
Query Start/End: Original strand, 375 - 456
Target Start/End: Complemental strand, 24060835 - 24060754
Alignment:
| Q |
375 |
gtcccgaccttagtgattgcaggtgaaactcacctaaacttattgtagccgactttctatatcctttttaaaccctaaaccc |
456 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
24060835 |
gtcccgaccttagtgattgcaggtgaaactcacctaaacttattgtagccgattttctatatcctttttaaaccctaaaccc |
24060754 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #5
Raw Score: 69; E-Value: 1e-30
Query Start/End: Original strand, 43 - 140
Target Start/End: Complemental strand, 23688963 - 23688866
Alignment:
| Q |
43 |
gacggtttggtaggatttctctcattgagtagtctttttggtctaactagnnnnnnngaattaaaagagcagttcgaggtaattatatgtatgattga |
140 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| ||||||||||||||| ||||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
23688963 |
gacggtttggtaggatttctctcattgagtagtccttttggtctaactagtttttttgaattaaaagagcagttcgaggtaattatatgtgtgattga |
23688866 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #6
Raw Score: 69; E-Value: 1e-30
Query Start/End: Original strand, 43 - 140
Target Start/End: Complemental strand, 24061200 - 24061103
Alignment:
| Q |
43 |
gacggtttggtaggatttctctcattgagtagtctttttggtctaactagnnnnnnngaattaaaagagcagttcgaggtaattatatgtatgattga |
140 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| ||||||||||||||| ||||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
24061200 |
gacggtttggtaggatttctctcattgagtagtccttttggtctaactagtttttttgaattaaaagagcagttcgaggtaattatatgtgtgattga |
24061103 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #7
Raw Score: 55; E-Value: 3e-22
Query Start/End: Original strand, 533 - 591
Target Start/End: Complemental strand, 23688428 - 23688370
Alignment:
| Q |
533 |
tttataagtcagggatatgtgatgcatcagggtgagtctgaaatatcccaactaccccc |
591 |
Q |
| |
|
||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
23688428 |
tttataagtcagggatatgtgatgcatcaaggtgagtctgaaatatcccaactaccccc |
23688370 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #8
Raw Score: 55; E-Value: 3e-22
Query Start/End: Original strand, 533 - 591
Target Start/End: Complemental strand, 24060665 - 24060607
Alignment:
| Q |
533 |
tttataagtcagggatatgtgatgcatcagggtgagtctgaaatatcccaactaccccc |
591 |
Q |
| |
|
||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
24060665 |
tttataagtcagggatatgtgatgcatcaaggtgagtctgaaatatcccaactaccccc |
24060607 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 29; Significance: 0.0000008; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 29; E-Value: 0.0000008
Query Start/End: Original strand, 270 - 310
Target Start/End: Complemental strand, 1136195 - 1136155
Alignment:
| Q |
270 |
ttttttcaaatttaatagataattgtcgatgagtgttgact |
310 |
Q |
| |
|
|||| |||||||||||| |||||||||||||| |||||||| |
|
|
| T |
1136195 |
ttttatcaaatttaataaataattgtcgatgaatgttgact |
1136155 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University