View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF21648_low_40 (Length: 242)
Name: NF21648_low_40
Description: NF21648
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF21648_low_40 |
 |  |
|
| [»] chr2 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 221; Significance: 1e-122; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 221; E-Value: 1e-122
Query Start/End: Original strand, 18 - 242
Target Start/End: Complemental strand, 38489297 - 38489073
Alignment:
| Q |
18 |
gtatggactaacttgattaaatctttacagtttttgaaactaatttggggataatgaacaaacttgacaaaattgggattttactaaatatagtgtgcct |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38489297 |
gtatggactaacttgattaaatctttacagtttttgaaaccaatttggggataatgaacaaacttgacaaaattgggattttactaaatatagtgtgcct |
38489198 |
T |
 |
| Q |
118 |
taaaacaagttctttgttacttgatattgagctaagaatgtagttgtgcctactcactggtttctattacaggaactataaatagtgtgccttaaaaata |
217 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38489197 |
taaaacaagttctttgttacttgatattgagctaagaatgtagttgtgcctactcactggtttctattacaggaactataaatagtgtgccttaaaaata |
38489098 |
T |
 |
| Q |
218 |
tatattttttggtcaagttttttat |
242 |
Q |
| |
|
||||||||||||||||||||||||| |
|
|
| T |
38489097 |
tatattttttggtcaagttttttat |
38489073 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 34; Significance: 0.0000000003; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 19 - 76
Target Start/End: Original strand, 31721269 - 31721326
Alignment:
| Q |
19 |
tatggactaacttgattaaatctttacagtttttgaaactaatttggggataatgaac |
76 |
Q |
| |
|
|||||||||| ||||||||| |||| | ||||||| ||||||||||| |||||||||| |
|
|
| T |
31721269 |
tatggactaaattgattaaagctttgctgtttttggaactaatttggagataatgaac |
31721326 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University