View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF21648_low_41 (Length: 241)
Name: NF21648_low_41
Description: NF21648
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF21648_low_41 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 190; Significance: 1e-103; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 190; E-Value: 1e-103
Query Start/End: Original strand, 19 - 233
Target Start/End: Original strand, 1460150 - 1460370
Alignment:
| Q |
19 |
cctccaccgttgaagtttccggctgagacattctgttacgacggcaaggtgttcttcatgattaggttgacaaacagggttagggttggaagcgaatagc |
118 |
Q |
| |
|
||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
1460150 |
cctccaccgctgaagtttccggctgagacattctgttacgacggcaaggtgttcttcatgattaggttgacagacagggttagggttggaagcgaatagc |
1460249 |
T |
|
| Q |
119 |
ttttaaaagcaacaagaattagggtttcgataggcaaggtttacacttgaattgggttgggccgtatttca------ccaaatccaaatcaatcagttgt |
212 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
1460250 |
ttttaaaagcaacaagaattagggtttcgataggcaaggtttacacttgaattgggttgggccgtatttcaccaaatccaaatccaaatcaatcagttgt |
1460349 |
T |
|
| Q |
213 |
ctttagaaaattattcatctc |
233 |
Q |
| |
|
||||||||||||||||||||| |
|
|
| T |
1460350 |
ctttagaaaattattcatctc |
1460370 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University