View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF21648_low_43 (Length: 238)
Name: NF21648_low_43
Description: NF21648
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF21648_low_43 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 205; Significance: 1e-112; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 205; E-Value: 1e-112
Query Start/End: Original strand, 1 - 221
Target Start/End: Original strand, 21597314 - 21597534
Alignment:
| Q |
1 |
cattgaaccaattaaaccaataggtatatctcttgaagggtttttagtttcttcagccatagttgcaaccatatcaaaaccggtataagaccaatacaca |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
21597314 |
cattgaaccaattaaaccaataggtatatctctagaagggtttttagtttcttcagccatagttgcaaccatatcgaaaccggtataagaccaatacaca |
21597413 |
T |
|
| Q |
101 |
acagctgcagcgttaaaaacacctttaacaccgtaaggaaaaaacggtgttaaatttgacgacttcccgtgtataaaaccgatcacaataataaaaccga |
200 |
Q |
| |
|
|||||||| |||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
21597414 |
acagctgcggcgttaaaaacacctttaacaccgtaaggaaaaaacggtgttaaatttgaagacttcccgtgtataaaaccgatcacaataataaaaccga |
21597513 |
T |
|
| Q |
201 |
tgataaaaattgtaacaattg |
221 |
Q |
| |
|
||||||||||||||||||||| |
|
|
| T |
21597514 |
tgataaaaattgtaacaattg |
21597534 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University