View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF21648_low_47 (Length: 219)
Name: NF21648_low_47
Description: NF21648
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF21648_low_47 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 181; Significance: 6e-98; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 181; E-Value: 6e-98
Query Start/End: Original strand, 18 - 202
Target Start/End: Original strand, 39608961 - 39609145
Alignment:
| Q |
18 |
agttataaatatccaatttgtaatcctcaagtaaaaacccaaaaatactcggaaggtataaccgctccaaccccaagcatggcagatttgatggtaatga |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39608961 |
agttataaatatccaatttgtaatcctcaagtaaaaacccaaaaatactcggaaggtacaaccgctccaaccccaagcatggcagatttgatggtaatga |
39609060 |
T |
|
| Q |
118 |
aggagattgaagacaaagcgtccaaactcagaatcttcaggtatatatatcgatcaacttcttctttactttcttgttttctgtg |
202 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39609061 |
aggagattgaagacaaagcgtccaaactcagaatcttcaggtatatatatcgatcaacttcttctttactttcttgttttctgtg |
39609145 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University