View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF21650_high_15 (Length: 244)
Name: NF21650_high_15
Description: NF21650
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF21650_high_15 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 158; Significance: 3e-84; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 158; E-Value: 3e-84
Query Start/End: Original strand, 12 - 231
Target Start/End: Complemental strand, 26311104 - 26310886
Alignment:
| Q |
12 |
atgatctgtccaccaccgggaacctcatgagattcatgttaacacaatgccatggaatgaagatcgactagaccgaccccaaagtcctagtttggacaag |
111 |
Q |
| |
|
||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
26311104 |
atgatctgtccaccatcgggaacctcatgagattcatgttaacacaatgccatggaatgaagatcgactagaccgaccccaaagtcctagtttggacaag |
26311005 |
T |
|
| Q |
112 |
gaggatagtcttgactcgccttaccttcttcatgccacaaagctacttccgaggaatt-aagtcttgattgtaactcaaaagtat---aacatgtcccct |
207 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| |||||||||||||||| |||||| | ||||||||||| |||||||||||| |
|
|
| T |
26311004 |
gaggatagtcttgactcgccttaccttcttcatgccacaaaactacttccgaggaattaaagtctcctt-----ctcaaaagtataacaacatgtcccct |
26310910 |
T |
|
| Q |
208 |
tctcaaaaaattcacatggaaacc |
231 |
Q |
| |
|
||||||||||| |||||||||||| |
|
|
| T |
26310909 |
tctcaaaaaatccacatggaaacc |
26310886 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 41 - 85
Target Start/End: Complemental strand, 26316380 - 26316336
Alignment:
| Q |
41 |
agattcatgttaacacaatgccatggaatgaagatcgactagacc |
85 |
Q |
| |
|
|||||||||||||| ||||| |||||||||||||||||||||||| |
|
|
| T |
26316380 |
agattcatgttaacgcaatgtcatggaatgaagatcgactagacc |
26316336 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University