View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF21650_high_6 (Length: 320)
Name: NF21650_high_6
Description: NF21650
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF21650_high_6 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 289; Significance: 1e-162; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 289; E-Value: 1e-162
Query Start/End: Original strand, 17 - 309
Target Start/End: Complemental strand, 40085285 - 40084993
Alignment:
| Q |
17 |
atatatggtcctcttcctcaaaccatttcaagcttgaagaatctcaggtttcttggtgttaacagaaacttcatctccggtgagattccggcggagttag |
116 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40085285 |
atatatggtcctcttcctcaaaccatttcaagcttgaagaatctcaggtttcttggtgttaacagaaacttcatctccggtgagattccggcggagttag |
40085186 |
T |
|
| Q |
117 |
gtgagttacgcagtcttcgaactattgatcttagttacaatcagctaaccggaaaaattcctccgacggtgggttcattaccggggttaaccaatctcat |
216 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40085185 |
gtgagttacgcagtcttcgaactattgatcttagttacaatcagctaaccggaaaaattcctccgacggtgggttcattaccggggttaaccaatctcat |
40085086 |
T |
|
| Q |
217 |
tctctgtcacaaccgtttaaccggttcacttccccggtttgattctcaaagcttaagccggttggacctaaagcacaactctctcacaggttc |
309 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
40085085 |
tctctgtcacaaccgtttaaccggttcacttccccggtttgattctcaaagcttaagccggttggacctaaagcacaactctctcaccggttc |
40084993 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 36; Significance: 0.00000000003; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 50 - 181
Target Start/End: Complemental strand, 37408796 - 37408665
Alignment:
| Q |
50 |
ttgaagaatctcaggtttcttggtgttaacagaaacttcatctccggtgagattccggcggagttaggtgagttacgcagtcttcgaactattgatctta |
149 |
Q |
| |
|
|||||||||||||||||||| ||| ||| | || ||||||||||||||||||||||| | | | ||| | | || | | | |||||||||||||| | |
|
|
| T |
37408796 |
ttgaagaatctcaggtttctcggtattagtcggaatttcatctccggtgagattccggcagggcttggtcaacttcgtaatgtccgaactattgatctaa |
37408697 |
T |
|
| Q |
150 |
gttacaatcagctaaccggaaaaattcctccg |
181 |
Q |
| |
|
||||||||||||| |||||| ||||||||| |
|
|
| T |
37408696 |
gttacaatcagctcgccggaactattcctccg |
37408665 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University