View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF21650_low_18 (Length: 238)
Name: NF21650_low_18
Description: NF21650
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF21650_low_18 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 170; Significance: 2e-91; HSPs: 3)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 170; E-Value: 2e-91
Query Start/End: Original strand, 13 - 221
Target Start/End: Original strand, 38092856 - 38093060
Alignment:
| Q |
13 |
agaagttgagacaaaccgatgattctcttcagaaagttatgtacatgaactgttggggtcaaggctaatggagacaacaaagcatgcagaattgactcaa |
112 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38092856 |
agaagttgagacaaaccgatgattctcttcagaaagttatgtacatgaactgttggggtcagggctaatggagacaacaaagcatgcagaattgactcaa |
38092955 |
T |
 |
| Q |
113 |
agggtgcagaaggaaagaaaccctatatgttgttttcttgaatgagaaatattgg-aaaaaggaaacaatgggattccttcggacaatttgatacgtcta |
211 |
Q |
| |
|
|||||||| ||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||| |||||||||| |
|
|
| T |
38092956 |
agggtgca-----caagaaaccctatatgttgttttcttgaatgagaaatattggaaaaaaggaaacaatgggattccttcggacaattcgatacgtcta |
38093050 |
T |
 |
| Q |
212 |
tgagaacaag |
221 |
Q |
| |
|
|||||||||| |
|
|
| T |
38093051 |
tgagaacaag |
38093060 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 59; E-Value: 4e-25
Query Start/End: Original strand, 10 - 80
Target Start/End: Original strand, 38089867 - 38089937
Alignment:
| Q |
10 |
aagagaagttgagacaaaccgatgattctcttcagaaagttatgtacatgaactgttggggtcaaggctaa |
80 |
Q |
| |
|
|||||||| |||||||||||||||||||||| |||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
38089867 |
aagagaagctgagacaaaccgatgattctctccagaaagttatgtacatgaattgttggggtcaaggctaa |
38089937 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #3
Raw Score: 43; E-Value: 0.000000000000001
Query Start/End: Original strand, 26 - 80
Target Start/End: Original strand, 38096137 - 38096191
Alignment:
| Q |
26 |
aaccgatgattctcttcagaaagttatgtacatgaactgttggggtcaaggctaa |
80 |
Q |
| |
|
||||||||||||||||| |||||||||||||||||| || ||||||||||||||| |
|
|
| T |
38096137 |
aaccgatgattctcttcggaaagttatgtacatgaattgctggggtcaaggctaa |
38096191 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University