View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF21650_low_2 (Length: 440)
Name: NF21650_low_2
Description: NF21650
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF21650_low_2 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 399; Significance: 0; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 399; E-Value: 0
Query Start/End: Original strand, 9 - 423
Target Start/End: Original strand, 53805596 - 53806010
Alignment:
| Q |
9 |
acatcatcaggaactgaggataaaacggtgtcgtggtggagataatcataacgtctataactgtgagtgcataattgagaattttcttctgtatcctccg |
108 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
53805596 |
acattatcaggaactgaggataaaacggtgtcgtggtggagataatcataacgtctataactgtgagtgcataattgagaattttcttctgtatcctccg |
53805695 |
T |
|
| Q |
109 |
gttctggttctgattcagaatgcagtgggacgtgttcagcatctgaatcagaactaaaagatgattttgagcgtggtggaggtggtgattttgagagtga |
208 |
Q |
| |
|
||||||||||||||||||||||||| |||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
53805696 |
gttctggttctgattcagaatgcagcgggacgtgttcagcatctgaatcagaactagaagatgattttgagcgtggtggaggtggtgattttgagagtga |
53805795 |
T |
|
| Q |
209 |
tggtttggtttcgccagaaaaatcttcaaattgcttgaagaaatgaaggagagtagggccaagtgttctgagggaatacatgtgtgccacgtgtgcatcg |
308 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
53805796 |
tggtttggtttcgccagaaaaatcttcaaattgcttgaagaaatgaaggagagtagggccaagtgttctgagggaatacatgtgtgccacgtgtgcatcg |
53805895 |
T |
|
| Q |
309 |
gcgagggagtagctttgacggagtgattcgtcgatgaatttgcaacggtcgcggcacaatgacacggccggaagccggtcaagtcttgaggcgttgcagc |
408 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
53805896 |
gcgagggagtagctttgacggagtgattcgtcgatgaatttgaaacggtcgcggcacaatgacacggccggaagccggtcaagtcttgaggcgttgcagc |
53805995 |
T |
|
| Q |
409 |
ccatcgttatgtttg |
423 |
Q |
| |
|
||||||||||||||| |
|
|
| T |
53805996 |
ccatcgttatgtttg |
53806010 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University