View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF21650_low_20 (Length: 213)
Name: NF21650_low_20
Description: NF21650
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF21650_low_20 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 153; Significance: 3e-81; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 153; E-Value: 3e-81
Query Start/End: Original strand, 42 - 198
Target Start/End: Original strand, 31068767 - 31068923
Alignment:
| Q |
42 |
aatttatatcaaacttggaagactcaaaaaatactcacttggcccaggtgagaactggcatatagatttgggttttgggatgaaaacgctgttgaaatgc |
141 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31068767 |
aatttatatcaaacttggaagactcaaaaaatagtcacttggcccaggtgagaactggcatatagatttgggttttgggatgaaaacgctgttgaaatgc |
31068866 |
T |
|
| Q |
142 |
ggcaaaaagtcgacatgcaccagtcccagataaagcctgaactgcagctattcgttt |
198 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31068867 |
ggcaaaaagtcgacatgcaccagtcccagataaagcctgaactgcagctattcgttt |
31068923 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 92; E-Value: 7e-45
Query Start/End: Original strand, 71 - 194
Target Start/End: Original strand, 31075634 - 31075757
Alignment:
| Q |
71 |
aatactcacttggcccaggtgagaactggcatatagatttgggttttgggatgaaaacgctgttgaaatgcggcaaaaagtcgacatgcaccagtcccag |
170 |
Q |
| |
|
|||||| |||||| ||||||| ||||||| |||||||||||||| ||||||||||| |||||||||||| |||| ||||||||||||||||||||||||| |
|
|
| T |
31075634 |
aatactgacttggaccaggtgggaactggtatatagatttgggtgttgggatgaaatcgctgttgaaatacggcgaaaagtcgacatgcaccagtcccag |
31075733 |
T |
|
| Q |
171 |
ataaagcctgaactgcagctattc |
194 |
Q |
| |
|
|||||||||||||||||||||||| |
|
|
| T |
31075734 |
ataaagcctgaactgcagctattc |
31075757 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University