View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF21652_high_2 (Length: 364)

Name: NF21652_high_2
Description: NF21652
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF21652_high_2
NF21652_high_2
[»] chr3 (1 HSPs)
chr3 (254-339)||(16302102-16302187)
[»] chr8 (1 HSPs)
chr8 (118-170)||(29429487-29429539)


Alignment Details
Target: chr3 (Bit Score: 82; Significance: 1e-38; HSPs: 1)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 82; E-Value: 1e-38
Query Start/End: Original strand, 254 - 339
Target Start/End: Complemental strand, 16302187 - 16302102
Alignment:
254 aaactatatgagcataagtttaccgtgtgtttcaactaggaatcagaacatgacaactttgaacattaaaatattcaactagacac 339  Q
    ||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
16302187 aaactatatgagcataaatttaccgtgtgtttcaactaggaatcagaacatgacaactttgaacattaaaatattcaactagacac 16302102  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8 (Bit Score: 29; Significance: 0.0000005; HSPs: 1)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 118 - 170
Target Start/End: Complemental strand, 29429539 - 29429487
Alignment:
118 taattagtagattacggaaatgcccttcaggagggcaaaattgaaaaattaac 170  Q
    ||||||| |||||||  ||||||||||||| |||||||||| | |||||||||    
29429539 taattagaagattaccaaaatgcccttcagaagggcaaaatggtaaaattaac 29429487  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University