View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF21652_low_2 (Length: 364)
Name: NF21652_low_2
Description: NF21652
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF21652_low_2 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 82; Significance: 1e-38; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 82; E-Value: 1e-38
Query Start/End: Original strand, 254 - 339
Target Start/End: Complemental strand, 16302187 - 16302102
Alignment:
| Q |
254 |
aaactatatgagcataagtttaccgtgtgtttcaactaggaatcagaacatgacaactttgaacattaaaatattcaactagacac |
339 |
Q |
| |
|
||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
16302187 |
aaactatatgagcataaatttaccgtgtgtttcaactaggaatcagaacatgacaactttgaacattaaaatattcaactagacac |
16302102 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 29; Significance: 0.0000005; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 118 - 170
Target Start/End: Complemental strand, 29429539 - 29429487
Alignment:
| Q |
118 |
taattagtagattacggaaatgcccttcaggagggcaaaattgaaaaattaac |
170 |
Q |
| |
|
||||||| ||||||| ||||||||||||| |||||||||| | ||||||||| |
|
|
| T |
29429539 |
taattagaagattaccaaaatgcccttcagaagggcaaaatggtaaaattaac |
29429487 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University