View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF21652_low_7 (Length: 202)
Name: NF21652_low_7
Description: NF21652
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF21652_low_7 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 135; Significance: 1e-70; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 135; E-Value: 1e-70
Query Start/End: Original strand, 7 - 182
Target Start/End: Original strand, 51757810 - 51757985
Alignment:
| Q |
7 |
ggatgtcgaagaatatgaagaatcacatgatttgtatttgcacaaccaagggcatggaccatgaagaatgatacgataatatactattatttggagccca |
106 |
Q |
| |
|
||||||||||||| | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
51757810 |
ggatgtcgaagaacacgaagaatcacatgatttgtatttgcacaaccaagggcatggaccatgaagaatgatacgataatatactattatctggagccca |
51757909 |
T |
|
| Q |
107 |
annnnnnnccacattcaggaaaatctcttccaagtctcaaaacaagttatatgaacatagtgcatgcatcagtagt |
182 |
Q |
| |
|
| ||||||||||||||||||||||||| ||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
51757910 |
atttttttccacattcaggaaaatctcttccaaatcttaaaacaagttatatgaacatagtgcatgcatcagtagt |
51757985 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University