View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF21653_high_2 (Length: 248)
Name: NF21653_high_2
Description: NF21653
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF21653_high_2 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 97; Significance: 9e-48; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 97; E-Value: 9e-48
Query Start/End: Original strand, 40 - 136
Target Start/End: Complemental strand, 44306671 - 44306575
Alignment:
| Q |
40 |
caaagagagaatatttaagatttatttatttttgagttaaataagatatattaattaccattagtgggtctttagaacaactgaacaatcttgttag |
136 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44306671 |
caaagagagaatatttaagatttatttatttttgagttaaataagatatattaattaccattagtgggtctttagaacaactgaacaatcttgttag |
44306575 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 196 - 245
Target Start/End: Complemental strand, 44306495 - 44306446
Alignment:
| Q |
196 |
gacactgaagaacttaaatataacaactaaaaagaaggattgatattgtt |
245 |
Q |
| |
|
|||| |||||||||||| |||||||||||||||| ||||||||||||||| |
|
|
| T |
44306495 |
gacattgaagaacttaagtataacaactaaaaaggaggattgatattgtt |
44306446 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University