View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF21654_high_16 (Length: 216)

Name: NF21654_high_16
Description: NF21654
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF21654_high_16
NF21654_high_16
[»] chr8 (2 HSPs)
chr8 (40-148)||(36879673-36879781)
chr8 (143-208)||(36879907-36879972)


Alignment Details
Target: chr8 (Bit Score: 109; Significance: 5e-55; HSPs: 2)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 109; E-Value: 5e-55
Query Start/End: Original strand, 40 - 148
Target Start/End: Complemental strand, 36879781 - 36879673
Alignment:
40 aaaaatattaattatatgtcaaaatatagatgttaccctcttaaaatcttcaaaaatcaactcagaaacatactactctaagagatcaaaattgaaggtt 139  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
36879781 aaaaatattaattatatgtcaaaatatagatgttaccctcttaaaatcttcaaaaatcaactcagaaacatactactctaagagatcaaaattgaaggtt 36879682  T
140 tatttcact 148  Q
    |||||||||    
36879681 tatttcact 36879673  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #2
Raw Score: 66; E-Value: 2e-29
Query Start/End: Original strand, 143 - 208
Target Start/End: Original strand, 36879907 - 36879972
Alignment:
143 ttcacttctactacccaacaataattattgattaccatcatacttgaccataataacgatgatgtc 208  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
36879907 ttcacttctactacccaacaataattattgattaccatcatacttgaccataataacgatgatgtc 36879972  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University