View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF21654_low_14 (Length: 253)
Name: NF21654_low_14
Description: NF21654
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF21654_low_14 |
 | |
|
| [»] scaffold0039 (1 HSPs) |
| | |
|
Alignment Details
Target: scaffold0039 (Bit Score: 199; Significance: 1e-108; HSPs: 1)
Name: scaffold0039
Description:
Target: scaffold0039; HSP #1
Raw Score: 199; E-Value: 1e-108
Query Start/End: Original strand, 27 - 241
Target Start/End: Complemental strand, 24553 - 24339
Alignment:
| Q |
27 |
ttgtgaacatactagcccacatgtttcttacgcaaagagtgaaaataaatgcaaacactccacaaatgaagctgaaagaaagtcctgaaattgctgaaag |
126 |
Q |
| |
|
||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
24553 |
ttgtgaacatactagcccacatgtttcttacacaaagagtgaaaataaatgcaaacactccacaaatgaagctgaaagaaagtcctgaaattgctgaaag |
24454 |
T |
|
| Q |
127 |
ttttgcttttgatggcttttgtgcacctatcatgttaccaactcttgttgaaacactattgcttagtgaataaggaaaaatgtacatcaatgaagtaatt |
226 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||| | |||||||||| |
|
|
| T |
24453 |
ttttgcttttgatggcttttgtgcacctatcatgttaccaactcttgttgaaacactattgcttagtgagtaaggaaaaatgtacataagtgaagtaatt |
24354 |
T |
|
| Q |
227 |
tggattaacaccccc |
241 |
Q |
| |
|
||||||||||||||| |
|
|
| T |
24353 |
tggattaacaccccc |
24339 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 44; Significance: 4e-16; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 44; E-Value: 4e-16
Query Start/End: Original strand, 77 - 184
Target Start/End: Original strand, 45845614 - 45845721
Alignment:
| Q |
77 |
gcaaacactccacaaatgaagctgaaagaaagtcctgaaattgctgaaagttttgcttttgatggcttttgtgcacctatcatgttaccaactcttgttg |
176 |
Q |
| |
|
|||||||| || |||||||||| ||| |||||| ||||||||||||||||||||||||||||||||| ||||| | ||||||||||||| || | |
|
|
| T |
45845614 |
gcaaacacacctaaaatgaagctacaagtgagtcctacaattgctgaaagttttgcttttgatggcttttgagcaccaagtttgttaccaactctagtgg |
45845713 |
T |
|
| Q |
177 |
aaacacta |
184 |
Q |
| |
|
|||||||| |
|
|
| T |
45845714 |
aaacacta |
45845721 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University