View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF21654_low_16 (Length: 216)
Name: NF21654_low_16
Description: NF21654
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF21654_low_16 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 109; Significance: 5e-55; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 109; E-Value: 5e-55
Query Start/End: Original strand, 40 - 148
Target Start/End: Complemental strand, 36879781 - 36879673
Alignment:
| Q |
40 |
aaaaatattaattatatgtcaaaatatagatgttaccctcttaaaatcttcaaaaatcaactcagaaacatactactctaagagatcaaaattgaaggtt |
139 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36879781 |
aaaaatattaattatatgtcaaaatatagatgttaccctcttaaaatcttcaaaaatcaactcagaaacatactactctaagagatcaaaattgaaggtt |
36879682 |
T |
 |
| Q |
140 |
tatttcact |
148 |
Q |
| |
|
||||||||| |
|
|
| T |
36879681 |
tatttcact |
36879673 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 66; E-Value: 2e-29
Query Start/End: Original strand, 143 - 208
Target Start/End: Original strand, 36879907 - 36879972
Alignment:
| Q |
143 |
ttcacttctactacccaacaataattattgattaccatcatacttgaccataataacgatgatgtc |
208 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36879907 |
ttcacttctactacccaacaataattattgattaccatcatacttgaccataataacgatgatgtc |
36879972 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University