View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF21654_low_8 (Length: 347)
Name: NF21654_low_8
Description: NF21654
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF21654_low_8 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 326; Significance: 0; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 326; E-Value: 0
Query Start/End: Original strand, 1 - 330
Target Start/End: Complemental strand, 36879151 - 36878822
Alignment:
| Q |
1 |
aatgtgtattcaccctttttattggtacatgtcattttctcaaaattcattgcagcgttgaactcagttttctagctaaacaagaatttaaatgatgaaa |
100 |
Q |
| |
|
||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36879151 |
aatgtgtattcaccctttttattggcacatgtcattttctcaaaattcattgcagcgttgaactcagttttctagctaaacaagaatttaaatgatgaaa |
36879052 |
T |
 |
| Q |
101 |
caagaccatgaccatgaccggttcttctgttgtgtagaatttatttttccaaacaatggtatcaccaagtgtcaatgagtcaagtcaactatacccccga |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36879051 |
caagaccatgaccatgaccggttcttctgttgtgtagaatttatttttccaaacaatggtatcaccaagtgtcaatgagtcaagtcaactatacccccga |
36878952 |
T |
 |
| Q |
201 |
tccattctcacaccacatgcataaatacccccaaaaaacacaaccttaagacagcacaattagataattttcataaagtgtcatacatatggagaccatt |
300 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36878951 |
tccattctcacaccacatgcataaatacccccaaaaaacacaaccttaagacagcacaattagataattttcataaagtgtcatacatatggagaccatt |
36878852 |
T |
 |
| Q |
301 |
tttgtggttctagtgatctttgttattgct |
330 |
Q |
| |
|
|||||||||||||||||||||||||||||| |
|
|
| T |
36878851 |
tttgtggttctagtgatctttgttattgct |
36878822 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University