View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF21655_high_2 (Length: 292)
Name: NF21655_high_2
Description: NF21655
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF21655_high_2 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 155; Significance: 3e-82; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 155; E-Value: 3e-82
Query Start/End: Original strand, 37 - 239
Target Start/End: Complemental strand, 23144642 - 23144440
Alignment:
| Q |
37 |
tctccttgtgaataatatgctttgcaagattaaatttcttgtcgattacactttcaggggattgtaaagatcagaaaactggaattaaagggcgatgtgt |
136 |
Q |
| |
|
||||||| | |||||||||||||||||||||||| |||||||||||| ||||||||||||||||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
23144642 |
tctccttattaataatatgctttgcaagattaaacttcttgtcgatttaactttcaggggattgtaaagatcagaaaactggaattaaggggcgatgtgt |
23144543 |
T |
|
| Q |
137 |
tgtgggggcgattaaaaattacaccaaccagctcatcgattacggcaatgccataaaacctaaatgtaaatgctcctttccaaattaataaactaagttg |
236 |
Q |
| |
|
||||||||| |||| ||||||||||||||||||| ||||||| |||| |||||||||||||||||||||||||||||||||||||||||||||||| ||| |
|
|
| T |
23144542 |
tgtgggggctattacaaattacaccaaccagctcctcgattatggcagtgccataaaacctaaatgtaaatgctcctttccaaattaataaactaatttg |
23144443 |
T |
|
| Q |
237 |
tac |
239 |
Q |
| |
|
||| |
|
|
| T |
23144442 |
tac |
23144440 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 89 - 141
Target Start/End: Complemental strand, 23135471 - 23135419
Alignment:
| Q |
89 |
ttcaggggattgtaaagatcagaaaactggaattaaagggcgatgtgttgtgg |
141 |
Q |
| |
|
|||||||||||||| |||||| |||||||||| || ||||||||||| |||| |
|
|
| T |
23135471 |
ttcaggggattgtatagatcataaaactggaacaaaggggcgatgtgtcgtgg |
23135419 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University