View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF21656_high_19 (Length: 472)
Name: NF21656_high_19
Description: NF21656
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF21656_high_19 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 165; Significance: 5e-88; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 165; E-Value: 5e-88
Query Start/End: Original strand, 22 - 186
Target Start/End: Complemental strand, 11612338 - 11612174
Alignment:
| Q |
22 |
atcaaaactcaagagggtattctgaattgtgaattgtgattgtgataaagtggttcatattcttcatgaatttgtggtggaagctagtgtgaaagttgaa |
121 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
11612338 |
atcaaaactcaagagggtattctgaattgtgaattgtgattgtgataaagtggttcatattcttcatgaatttgtggtggaagctagtgtgaaagttgaa |
11612239 |
T |
|
| Q |
122 |
aaatgttcaacggtttcatatggggaattaaagagagatgatggtgggtgacagaagagcacaga |
186 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
11612238 |
aaatgttcaacggtttcatatggggaattaaagagagatgatggtgggtgacagaagagcacaga |
11612174 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 101; E-Value: 7e-50
Query Start/End: Original strand, 298 - 452
Target Start/End: Complemental strand, 11612061 - 11611905
Alignment:
| Q |
298 |
catgaatgttgaatagtgttttgctatgctatgtttgttgtgagtgtctgnnnnnnnctctttcttaatatgtgtgtgtgtcagttgcataagtcattat |
397 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
11612061 |
catgaatgttgaatagtgttttgctatgctatgtttgttgtgagtgtctgtttttttctctttcttaatatgtgtgtgtgtcagttgcataagtcattat |
11611962 |
T |
|
| Q |
398 |
caagattgcataa--nnnnnnnnatctagggatgagggtccttgtttagtttgaata |
452 |
Q |
| |
|
||||||||||||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
11611961 |
caagattgcataattttttttttatctagggatgagggtccttgtttagtttgaata |
11611905 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University