View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF21656_high_46 (Length: 263)
Name: NF21656_high_46
Description: NF21656
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF21656_high_46 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 209; Significance: 1e-114; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 209; E-Value: 1e-114
Query Start/End: Original strand, 16 - 241
Target Start/End: Complemental strand, 52876970 - 52876744
Alignment:
| Q |
16 |
atcaaatagattcaataaatatctctatcatgagtgagttgtaaaaatcatta--gagacaacaacaaaccatttttcaatgcgttgttgtagaaagttt |
113 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
52876970 |
atcaaatagattcaataaatatctctatcatgagtgagttgtaaaaatcattattgagacaacaa-aaaccatttttcaatgcgttgttgtagaaagttt |
52876872 |
T |
 |
| Q |
114 |
gttatggaatcaagcaacgtataaagtttgtcaatgacaatacacaatcacaagaaactttgttggaaaaaatgcactatatgtgtttgtgcatacgtca |
213 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52876871 |
gttatggaatcaagcaacgtataaagtttgtcaatgacaatacacaatcacaagaaactttgttggaaaaaatgcactatatgtgtttgtgcatacgtca |
52876772 |
T |
 |
| Q |
214 |
acatgttcatttttaagtatgtagacaa |
241 |
Q |
| |
|
|||||||||||||||||||||||||||| |
|
|
| T |
52876771 |
acatgttcatttttaagtatgtagacaa |
52876744 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University