View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF21656_high_55 (Length: 236)

Name: NF21656_high_55
Description: NF21656
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF21656_high_55
NF21656_high_55
[»] chr1 (1 HSPs)
chr1 (18-218)||(3310950-3311150)


Alignment Details
Target: chr1 (Bit Score: 193; Significance: 1e-105; HSPs: 1)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 193; E-Value: 1e-105
Query Start/End: Original strand, 18 - 218
Target Start/End: Original strand, 3310950 - 3311150
Alignment:
18 agagaggagaaatgagtgctgctgcttttgcagattgaactataaactaggtctgagtgagagggttttcaactgtaaaaatatcttcataaatgacaaa 117  Q
    |||||||||||||||||| |||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
3310950 agagaggagaaatgagtgttgctgcttttgcagattgcactataaactaggtctgagtgagagggttttcaactgtaaaaatatcttcataaatgacaaa 3311049  T
118 tatgaggcttggacatggagcagccttttgtacatgttgtgtgtggcgtgtgtgagaggtcaagaaagagacactactcttaaatgctcctttgcttttc 217  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
3311050 tatgaggcttggacatggagcagccttttgtacatgttgtgtgtggcgtgtgtgagaggtcaagaaagagacactactcttaaatgctcctttgcttttc 3311149  T
218 c 218  Q
    |    
3311150 c 3311150  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University