View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF21656_high_55 (Length: 236)
Name: NF21656_high_55
Description: NF21656
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF21656_high_55 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 193; Significance: 1e-105; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 193; E-Value: 1e-105
Query Start/End: Original strand, 18 - 218
Target Start/End: Original strand, 3310950 - 3311150
Alignment:
| Q |
18 |
agagaggagaaatgagtgctgctgcttttgcagattgaactataaactaggtctgagtgagagggttttcaactgtaaaaatatcttcataaatgacaaa |
117 |
Q |
| |
|
|||||||||||||||||| |||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3310950 |
agagaggagaaatgagtgttgctgcttttgcagattgcactataaactaggtctgagtgagagggttttcaactgtaaaaatatcttcataaatgacaaa |
3311049 |
T |
 |
| Q |
118 |
tatgaggcttggacatggagcagccttttgtacatgttgtgtgtggcgtgtgtgagaggtcaagaaagagacactactcttaaatgctcctttgcttttc |
217 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3311050 |
tatgaggcttggacatggagcagccttttgtacatgttgtgtgtggcgtgtgtgagaggtcaagaaagagacactactcttaaatgctcctttgcttttc |
3311149 |
T |
 |
| Q |
218 |
c |
218 |
Q |
| |
|
| |
|
|
| T |
3311150 |
c |
3311150 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University