View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF21656_high_60 (Length: 228)
Name: NF21656_high_60
Description: NF21656
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF21656_high_60 |
 | |
|
| [»] chr5 (1 HSPs) |
| |
|
Alignment Details
Target: chr5 (Bit Score: 140; Significance: 2e-73; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 140; E-Value: 2e-73
Query Start/End: Original strand, 62 - 228
Target Start/End: Original strand, 38403947 - 38404120
Alignment:
| Q |
62 |
gtttttcatgacaaaaagtaaaggtaatatatgttgattgttcagactcttttatgcgtaacaaaatcaaatataatttgttgaaataacaatacttaag |
161 |
Q |
| |
|
|||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38403947 |
gtttttgatgacaaaaagtaaaggtaatatatgttgattgttcagactcttttatgcgtaacaaaatcaaatataatttgttgaaataacaatacttaag |
38404046 |
T |
|
| Q |
162 |
ttaaacaaagaagagagaaatacgagtgagtttggaagaa-------taaggagatgccatgagtgaattgcat |
228 |
Q |
| |
|
||||||||||||||| |||||||||||||||||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
38404047 |
ttaaacaaagaagagggaaatacgagtgagtttggaagaataaggattaaggagatgccatgagtgaattgcat |
38404120 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University