View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF21656_high_9 (Length: 568)

Name: NF21656_high_9
Description: NF21656
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF21656_high_9
NF21656_high_9
[»] chr1 (1 HSPs)
chr1 (411-455)||(2839902-2839946)


Alignment Details
Target: chr1 (Bit Score: 45; Significance: 2e-16; HSPs: 1)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 411 - 455
Target Start/End: Original strand, 2839902 - 2839946
Alignment:
411 acgctggaaggtgttgtggtgagtagggttagggttgagaagggt 455  Q
    |||||||||||||||||||||||||||||||||||||||||||||    
2839902 acgctggaaggtgttgtggtgagtagggttagggttgagaagggt 2839946  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University