View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF21656_low_37 (Length: 340)
Name: NF21656_low_37
Description: NF21656
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF21656_low_37 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 262; Significance: 1e-146; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 262; E-Value: 1e-146
Query Start/End: Original strand, 1 - 330
Target Start/End: Original strand, 26552683 - 26553021
Alignment:
| Q |
1 |
attaggattacgtgtacctatgattacgatattacctatatatccggttaacataaggtgttatccagggctccattctgaaaatatgtatatcggtaaa |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
26552683 |
attaggattacgtgtacctatgattacgatattacctatatatccggttaacataaggtgttatccagggctccattctgagaatatgtatatcggtaaa |
26552782 |
T |
 |
| Q |
101 |
atgcttgagaccttttttaaagccatgctctatcagtgc---------ctctaactcgattactttcaaataagggcttttgtcaaggtctttgcaatac |
191 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
26552783 |
atgcttgagaccttttttaaagccatgctctatcagtgatgaatgtggctctaactcgattactttcaaataagggcttttgtcaaggtctttgcaatac |
26552882 |
T |
 |
| Q |
192 |
attacctgcatagccgtggtgcgcaacgtagactgttagtttagcatactcttttcnnnnnnnacaagttaaatttagtgtcgaggtgggttgaatttat |
291 |
Q |
| |
|
|||||||||| |||||||||| ||||||| |||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
26552883 |
attacctgcaaagccgtggtgtgcaacgtggactgttagtttagcatactcttttctttttttacaagttaaatttagtgtcgaggtgggttgaatttat |
26552982 |
T |
 |
| Q |
292 |
gcgagtggtagatgccagttggaattttatccgcctttg |
330 |
Q |
| |
|
||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
26552983 |
gcgagtggtagatgccagttggaattttatccgtctttg |
26553021 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University