View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF21656_low_45 (Length: 271)
Name: NF21656_low_45
Description: NF21656
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF21656_low_45 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 219; Significance: 1e-120; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 219; E-Value: 1e-120
Query Start/End: Original strand, 17 - 255
Target Start/End: Original strand, 11612657 - 11612895
Alignment:
| Q |
17 |
caaaggataagcttacaagggttatcttagaaattgcttaatgttaaagattttgttatggttggttggtatgactgtgagagtggacctgttacagttc |
116 |
Q |
| |
|
||||||||||||||| |||||||| |||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
11612657 |
caaaggataagcttaaaagggttacattagaaattgcttaatgttaaagattttgttatggttggttggtgtgactgtgagagtggacctgttacagttc |
11612756 |
T |
 |
| Q |
117 |
agctggtctttatcttcaacatgaagccttttttaattttcatgtttctatatagtttggtatgatgtaatctagcttctgcttttgtcctcactctaat |
216 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
11612757 |
agctggtctttatcttcaacatgaagccttttttaattttcatgtttctatatagtttggtatgatgtaatctagcttctgcttttgtcctcactctaat |
11612856 |
T |
 |
| Q |
217 |
tgattttgtaaattatttccattgatctagtttcttctg |
255 |
Q |
| |
|
|||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
11612857 |
tgattttgtaaagtatttccattgatctagtttcttctg |
11612895 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University