View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF21656_low_48 (Length: 263)
Name: NF21656_low_48
Description: NF21656
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF21656_low_48 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 222; Significance: 1e-122; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 222; E-Value: 1e-122
Query Start/End: Original strand, 23 - 252
Target Start/End: Complemental strand, 24230764 - 24230535
Alignment:
| Q |
23 |
gacagcgcgattggttcctcagattagtcaatccttgcaccggatacaaacttttaaaaaataaagtattgaagctttccagaggacacaaattgtattg |
122 |
Q |
| |
|
|||||||||||||||||| |||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
24230764 |
gacagcgcgattggttccccagattagtcaatccttgcaccggatacaaacttataaaaaataaagtattgaagctttccagaggacacaaattgtattg |
24230665 |
T |
|
| Q |
123 |
cctcagtgttgttcaaagtgaattaaacatccagagacaaaaaatcaaacagcttcaaagcaaggagaagctactgtgcaatgcaaattgcaaccaaaat |
222 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
24230664 |
cctcagtgttgttcaaagtgaattaaacatccagagacaaaaaatcaaacagcttcaaagcaaggagaagctactgtgcaatgcaaattgcaaccaaaat |
24230565 |
T |
|
| Q |
223 |
agaaacaaactttatactcacccacttcat |
252 |
Q |
| |
|
|||||||||||||||||||||||||||||| |
|
|
| T |
24230564 |
agaaacaaactttatactcacccacttcat |
24230535 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University