View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF21656_low_54 (Length: 249)
Name: NF21656_low_54
Description: NF21656
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF21656_low_54 |
 |  |
|
| [»] chr6 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 212; Significance: 1e-116; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 212; E-Value: 1e-116
Query Start/End: Original strand, 13 - 249
Target Start/End: Complemental strand, 16293995 - 16293757
Alignment:
| Q |
13 |
aatataaatgttctaaaagaatacttttgaacagcacacaatcattattttttccgagtctgtacttgtgaactcgtgtcacgggtggagaatttgtttt |
112 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
16293995 |
aatataaatgttctaaaagaatacttttgaacagcacacaatcattattttttctgagtctgtatttgtgaactcgtgtcacgggtggagaatttgtttt |
16293896 |
T |
 |
| Q |
113 |
ccatagtcatttgtttgtggtttcatgcattgttttttggtgatatgcaaacacttgagcattaaaacaaagtagtgacgaagtgattttagaaactcaa |
212 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
16293895 |
ccatagtcatttgtttgtggtttcatgcattgttttttggtgatatgcaaacacttgagcattaaaacaaagtagtgaggaagtgattttagaaactcaa |
16293796 |
T |
 |
| Q |
213 |
ttgtaaac--aatctctggtataagtaaacatccaaaat |
249 |
Q |
| |
|
|||||||| ||||| ||||||||||||||||||||||| |
|
|
| T |
16293795 |
ttgtaaacaaaatctttggtataagtaaacatccaaaat |
16293757 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University