View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF21656_low_55 (Length: 237)
Name: NF21656_low_55
Description: NF21656
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF21656_low_55 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 166; Significance: 6e-89; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 166; E-Value: 6e-89
Query Start/End: Original strand, 16 - 221
Target Start/End: Complemental strand, 38548973 - 38548768
Alignment:
| Q |
16 |
aactataaacatgtttgtatgataaagagaactgcaaattattaaattaaatgtatgttttgtaatcattgatagcggatagctatttagcattgtttca |
115 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| | || ||||||||||||| |
|
|
| T |
38548973 |
aactataaacatgtttgtatgataaagagaactgcaaattattaaattaaatgtatgttttgtaatcattgatagctatttagaatatagcattgtttca |
38548874 |
T |
 |
| Q |
116 |
gagttgagcacatgttgcttttctgcagctaatctgcaagttagatcataagcaaagaaatatcacgttagaaatcaataggctcggtcactaatctatt |
215 |
Q |
| |
|
||||||||||| |||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38548873 |
gagttgagcacctgttgcttttctgcagctaatctgcaagttagatcataagcaaacaaatatcacgttagaaatcaataggctcggtcactaatctatt |
38548774 |
T |
 |
| Q |
216 |
tgttaa |
221 |
Q |
| |
|
|||||| |
|
|
| T |
38548773 |
tgttaa |
38548768 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University