View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF21656_low_59 (Length: 230)
Name: NF21656_low_59
Description: NF21656
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF21656_low_59 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 104; Significance: 5e-52; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 104; E-Value: 5e-52
Query Start/End: Original strand, 2 - 212
Target Start/End: Original strand, 885538 - 885749
Alignment:
| Q |
2 |
gatccaaattgtaaccaaaacatacataattgactcattcggttaaatttaactctattagtnnnnnnnn--gtaatatttttgtatgaaatagattgtc |
99 |
Q |
| |
|
||||||||||||||| ||||||||||||||||| |||||||||||||||||||||||| ||| || ||||||||||||||||||||||||| |
|
|
| T |
885538 |
gatccaaattgtaacaaaaacatacataattgattcattcggttaaatttaactctatcagtaaaaaaaaaagttatatttttgtatgaaatagattgtc |
885637 |
T |
|
| Q |
100 |
attttgtgttcttaattaagaaatactannnnnnnnn--atttaatcttattatagttaatattattatatacattactcttaagtaaaatttccctata |
197 |
Q |
| |
|
||||| |||||||||||||||||||||| ||||||||||||||||||||||||| ||||||||||||||||||| ||||||||||||| |
|
|
| T |
885638 |
attttctgttcttaattaagaaatactatttttttatttatttaatcttattatagttaatatt---atatacattactcttaagttaaatttccctata |
885734 |
T |
|
| Q |
198 |
taagcataagccatc |
212 |
Q |
| |
|
||||||||||||||| |
|
|
| T |
885735 |
taagcataagccatc |
885749 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 72 - 114
Target Start/End: Complemental strand, 31877003 - 31876961
Alignment:
| Q |
72 |
gtaatatttttgtatgaaatagattgtcattttgtgttcttaa |
114 |
Q |
| |
|
||||||||||| ||| |||| |||||||||||||||||||||| |
|
|
| T |
31877003 |
gtaatatttttatattaaatggattgtcattttgtgttcttaa |
31876961 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University