View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF21656_low_67 (Length: 213)

Name: NF21656_low_67
Description: NF21656
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF21656_low_67
NF21656_low_67
[»] chr5 (1 HSPs)
chr5 (1-196)||(5740047-5740242)


Alignment Details
Target: chr5 (Bit Score: 192; Significance: 1e-104; HSPs: 1)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 192; E-Value: 1e-104
Query Start/End: Original strand, 1 - 196
Target Start/End: Original strand, 5740047 - 5740242
Alignment:
1 tgggtgatgttataattagtttttgcgatcaacttttaggattaagttaaccatggatgggtctcgttttattaaacttcaaaaggtttgtatgcatgtt 100  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
5740047 tgggtgatgttataattagtttttgcgatcaacttttaggattaagttaaccatggatgggtctcgttttattaaacttcaaaaggtttgtatgcatgtt 5740146  T
101 ttaatgcttatgttatgttttggtaaataatgttatctcataattcataaagtattttgtatttaattgttgttgcttattatctttagccatatt 196  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||    
5740147 ttaatgcttatgttatgttttggtaaataatgttatctcataattcataaagcattttgtatttaattgttgttgcttattatctttagccatatt 5740242  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University