View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF21656_low_68 (Length: 213)
Name: NF21656_low_68
Description: NF21656
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF21656_low_68 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 85; Significance: 1e-40; HSPs: 8)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 85; E-Value: 1e-40
Query Start/End: Original strand, 83 - 167
Target Start/End: Original strand, 41579167 - 41579251
Alignment:
| Q |
83 |
attgctactttgtgcatagccctaacttcagtgattatagtttcagcagtggtaggactagctactttgaacttgatccaattat |
167 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41579167 |
attgctactttgtgcatagccctaacttcagtgattatagtttcagcagtggtaggactagctactttgaacttgatccaattat |
41579251 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 85; E-Value: 1e-40
Query Start/End: Original strand, 89 - 197
Target Start/End: Original strand, 41589176 - 41589284
Alignment:
| Q |
89 |
actttgtgcatagccctaacttcagtgattatagtttcagcagtggtaggactagctactttgaacttgatccaattatagactcatacaactacagtta |
188 |
Q |
| |
|
|||||||| |||||||||||||||||||||||||||| ||||||| ||| ||||||| |||||||||||||||||||||||||||||||||||||| ||| |
|
|
| T |
41589176 |
actttgtggatagccctaacttcagtgattatagtttaagcagtgatagcactagctcctttgaacttgatccaattatagactcatacaactacaatta |
41589275 |
T |
 |
| Q |
189 |
caacccttt |
197 |
Q |
| |
|
||||||||| |
|
|
| T |
41589276 |
caacccttt |
41589284 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #3
Raw Score: 77; E-Value: 6e-36
Query Start/End: Original strand, 93 - 197
Target Start/End: Original strand, 41556535 - 41556639
Alignment:
| Q |
93 |
tgtgcatagccctaacttcagtgattatagtttcagcagtggtaggactagctactttgaacttgatccaattatagactcatacaactacagttacaac |
192 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| || ||||||| |||||||| ||||||||||||||||||||||||||| | | ||||| |
|
|
| T |
41556535 |
tgtgcatagccctaacttcagtgattatagtttcagcagtggcagcactagctcctttgaacctgatccaattatagactcatacaactataataacaac |
41556634 |
T |
 |
| Q |
193 |
ccttt |
197 |
Q |
| |
|
||||| |
|
|
| T |
41556635 |
ccttt |
41556639 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #4
Raw Score: 70; E-Value: 1e-31
Query Start/End: Original strand, 91 - 192
Target Start/End: Original strand, 41570251 - 41570352
Alignment:
| Q |
91 |
tttgtgcatagccctaacttcagtgattatagtttcagcagtggtaggactagctactttgaacttgatccaattatagactcatacaactacagttaca |
190 |
Q |
| |
|
||||||||||||||| || |||||||||||||||||||||||||||| ||||||| |||||||||||| ||||||||||| |||||||||||| ||||| |
|
|
| T |
41570251 |
tttgtgcatagccctgacatcagtgattatagtttcagcagtggtagcactagctcctttgaacttgaaccaattatagagacatacaactacaattaca |
41570350 |
T |
 |
| Q |
191 |
ac |
192 |
Q |
| |
|
|| |
|
|
| T |
41570351 |
ac |
41570352 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #5
Raw Score: 40; E-Value: 0.00000000000008
Query Start/End: Original strand, 20 - 59
Target Start/End: Original strand, 41579104 - 41579143
Alignment:
| Q |
20 |
caacttactgaaaaatcatttcatgatgttattgttcaca |
59 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41579104 |
caacttactgaaaaatcatttcatgatgttattgttcaca |
41579143 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #6
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 20 - 59
Target Start/End: Original strand, 41570098 - 41570137
Alignment:
| Q |
20 |
caacttactgaaaaatcatttcatgatgttattgttcaca |
59 |
Q |
| |
|
||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
41570098 |
caacttactgagaaatcatttcatgatgttattgttcaca |
41570137 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #7
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 20 - 59
Target Start/End: Original strand, 41589043 - 41589082
Alignment:
| Q |
20 |
caacttactgaaaaatcatttcatgatgttattgttcaca |
59 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
41589043 |
caacttactgaaaaatcatttcatgatgttattgctcaca |
41589082 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #8
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 20 - 59
Target Start/End: Original strand, 41556401 - 41556440
Alignment:
| Q |
20 |
caacttactgaaaaatcatttcatgatgttattgttcaca |
59 |
Q |
| |
|
||||| ||||| |||||||||||||||||||||||||||| |
|
|
| T |
41556401 |
caactcactgagaaatcatttcatgatgttattgttcaca |
41556440 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University