View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF21657_high_16 (Length: 401)
Name: NF21657_high_16
Description: NF21657
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF21657_high_16 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 126; Significance: 7e-65; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 126; E-Value: 7e-65
Query Start/End: Original strand, 162 - 396
Target Start/End: Complemental strand, 5037680 - 5037446
Alignment:
| Q |
162 |
actgcactcaggttacctaagccccgacggttccaactaataatacttaattattctaatgagatgtcatgccatagatcatggagaacttccaaccnnn |
261 |
Q |
| |
|
|||||||| ||||||| || |||| || |||| ||||| ||||| | ||||||||||||||||||||||||||| ||||| ||||||||||||||| |
|
|
| T |
5037680 |
actgcacttgggttacccaaaccccaacagttctaactagtaatattcaattattctaatgagatgtcatgccatggatcaaggagaacttccaaccaga |
5037581 |
T |
|
| Q |
262 |
nnnncggtccatgtttaatagaaaatatcaacagtacaaaattacaacaatcatacctaatcatcattgatgagtgaatatccagctgagaatgtcacaa |
361 |
Q |
| |
|
||||| ||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||| ||||| |
|
|
| T |
5037580 |
aaaatagtccacatttaatagaaaatatcaacggtacaaaattacaacaatcatacctaatcatcattgatgagtgaatattcagctgagaatgccacaa |
5037481 |
T |
|
| Q |
362 |
acagtgcagatagaacacaaatttcttcatctcac |
396 |
Q |
| |
|
|| |||||||||||||||||||||||||| |||| |
|
|
| T |
5037480 |
actatgcagatagaacacaaatttcttcatatcac |
5037446 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 89; E-Value: 9e-43
Query Start/End: Original strand, 20 - 136
Target Start/End: Complemental strand, 5037793 - 5037677
Alignment:
| Q |
20 |
tttacctacgctatcaacatcaaaacagaagttgaaagccaatacataacgcaaatcacttatattatttgaatacatgaaattctcatacaatatcata |
119 |
Q |
| |
|
||||||||||||||||||||||||||| ||||| ||| |||||||| ||||||||||||||||||||||||||| |||||||||||| |||||||||||| |
|
|
| T |
5037793 |
tttacctacgctatcaacatcaaaacaaaagtttaaacccaatacacaacgcaaatcacttatattatttgaattcatgaaattctcctacaatatcata |
5037694 |
T |
|
| Q |
120 |
gcattcgtcttatactg |
136 |
Q |
| |
|
|||||| |||||||||| |
|
|
| T |
5037693 |
gcattcatcttatactg |
5037677 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University