View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF21657_high_19 (Length: 367)
Name: NF21657_high_19
Description: NF21657
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF21657_high_19 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 245; Significance: 1e-136; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 245; E-Value: 1e-136
Query Start/End: Original strand, 22 - 356
Target Start/End: Complemental strand, 25616927 - 25616596
Alignment:
| Q |
22 |
atgcagtccttctaatagtgaagtagcttcgccttcgaggattgataagttcgcttgtttccaacttgtttgtgacatcacaaattctccattgttattt |
121 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||| |||||||||||||| ||||||||||| |
|
|
| T |
25616927 |
atgcagtccttctaatagtgaagtagcttcgcattcgaggattgataagttcgcttgtttccaacttgtttgtaacatcacaaattcttcattgttattt |
25616828 |
T |
|
| Q |
122 |
cgtacacagcactcaatggatgtaataccggctctttcgttaaatgccgcatccacattacatttgagcaagccataattaggcctctcccaatctgaac |
221 |
Q |
| |
|
|||||||||||| ||||| |||||||||| |||||| ||||||||| |||||||| |||| |||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
25616827 |
cgtacacagcacccaatgaatgtaataccagctcttcggttaaatgctgcatccacgttacgtttgagcaagccataattaggcctctcctaatctgaac |
25616728 |
T |
|
| Q |
222 |
tgctttgattccgaactgtaccagcccgcgtctgttgcaatctgttgacctcataccactgctgtcaagaatgcattgttttccttccaatactagctgg |
321 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| ||||||||||||| ||| |||||||| |
|
|
| T |
25616727 |
tgctttgattccgaactgtaccagcccgcgtctgttgcaatctgttgacctcataccactgctgccaagaattcattgttttcctttcaacactagctg- |
25616629 |
T |
|
| Q |
322 |
tagagttactcttaaactcttccacaccagttcat |
356 |
Q |
| |
|
||||||||| |||||||||||| ||||||||| |
|
|
| T |
25616628 |
--aagttactctcaaactcttccactccagttcat |
25616596 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 59; E-Value: 6e-25
Query Start/End: Original strand, 247 - 353
Target Start/End: Original strand, 25612416 - 25612522
Alignment:
| Q |
247 |
ccgcgtctgttgcaatctgttgacctcataccactgctgtcaagaatgcattgttttccttccaatactagctggtagagttactcttaaactcttccac |
346 |
Q |
| |
|
||||||||||||||| |||||||| ||||| |||| ||| |||||| |||| ||||||||||||| |||||||| | || ||||||| |||||||||||| |
|
|
| T |
25612416 |
ccgcgtctgttgcaacctgttgacttcatatcactactgccaagaacgcatagttttccttccaacactagctgatggaattactctcaaactcttccac |
25612515 |
T |
|
| Q |
347 |
accagtt |
353 |
Q |
| |
|
||||||| |
|
|
| T |
25612516 |
accagtt |
25612522 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University