View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF21657_high_29 (Length: 251)
Name: NF21657_high_29
Description: NF21657
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF21657_high_29 |
 | |
|
| [»] chr2 (1 HSPs) |
| |
|
Alignment Details
Target: chr2 (Bit Score: 212; Significance: 1e-116; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 212; E-Value: 1e-116
Query Start/End: Original strand, 11 - 251
Target Start/End: Original strand, 3285102 - 3285342
Alignment:
| Q |
11 |
aatgaaatggaaattaggtggggttatttatgatagagtttttatttttaggttcaaataatcatgacaaatnnnnnnngttggtcagatagtaaattca |
110 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||| |||||||| |
|
|
| T |
3285102 |
aatgaaatggaaattaggtggggttatttatgatagagtttttatttttaggttcaaataatcatgacaaataaaaaaagttggtcagatactaaattca |
3285201 |
T |
|
| Q |
111 |
gatttgacaattgacaaggtttttaagttttaacttcttccatcaaccaattgggaattgatgaataatcatgaatagaatctacaacacattaagttac |
210 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3285202 |
gatttgacaattgacaaggtttttaagttttaacttcttccatcaaccaattgggaattgatgaataatcatgaatagaatctacaacacattaagttac |
3285301 |
T |
|
| Q |
211 |
tatcgcatctctttaccaaaatgaagaaaagcttaagcata |
251 |
Q |
| |
|
||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3285302 |
tattgcatctctttaccaaaatgaagaaaagcttaagcata |
3285342 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University